Review



pcs2 7myc glut4 gfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc pcs2 7myc glut4 gfp
    Pcs2 7myc Glut4 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+7myc+glut4+gfp/EGFR-GFP+(Plasmid+%2332751)/pm41912478-69-9-12
    Average 94 stars, based on 85 article reviews
    pcs2 7myc glut4 gfp - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: REP-1 deficiency induces aberrant mitochondrial metabolic rewiring from glycolysis to lipid oxidation in CHM disease.
    Article Snippet: .. Cells were transfected at 80% confluence with 1g of PCS2-7MYC-GLUT4-GFP (modified from Addgene 32751) for 24h, using Lipofectamine 2000 (Invitrogen, 12566014), following the manufacturer’s protocol. .. Generation of shREP1 ARPE-19 cells ARPE-19 cells expressing sh-REP-1 against the target sequence “CGGTATGGCAACACTCCATTT” were obtained transducing WT with the lentiviral vector MISSION TRC2 pLKO.1-CMV-Neo at a concentration of 1x109 particles/ml (TRCN0000065179 - Sigma Aldrich).

    Modification:

    Article Title: REP-1 deficiency induces aberrant mitochondrial metabolic rewiring from glycolysis to lipid oxidation in CHM disease.
    Article Snippet: .. Cells were transfected at 80% confluence with 1g of PCS2-7MYC-GLUT4-GFP (modified from Addgene 32751) for 24h, using Lipofectamine 2000 (Invitrogen, 12566014), following the manufacturer’s protocol. .. Generation of shREP1 ARPE-19 cells ARPE-19 cells expressing sh-REP-1 against the target sequence “CGGTATGGCAACACTCCATTT” were obtained transducing WT with the lentiviral vector MISSION TRC2 pLKO.1-CMV-Neo at a concentration of 1x109 particles/ml (TRCN0000065179 - Sigma Aldrich).



    Similar Products

    pcs2 7myc glut4 gfp  (Addgene inc)
    94
    Addgene inc pcs2 7myc glut4 gfp
    Pcs2 7myc Glut4 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+7myc+glut4+gfp/EGFR-GFP+(Plasmid+%2332751)/pm41912478-69-9-12
    Average 94 stars, based on 1 article reviews
    pcs2 7myc glut4 gfp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results